Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCACACCGTTGCGGGACAGTCCCGG[A/G]CCACCCTGGGGTCCGCGACCCAACG
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 607170 | |||||||||||||||||||||||
Literature Links: |
CRELD1 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
CRELD1 - cysteine rich with EGF like domains 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRRT3 - proline rich transmembrane protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001318871.1 | 4371 | Intron | NP_001305800.1 | |||
NM_207351.4 | 4371 | Silent Mutation | GGC,GGT | G,G 785 | NP_997234.3 | |
XM_011533628.2 | 4371 | Silent Mutation | GGC,GGT | G,G 785 | XP_011531930.1 | |
XM_011533629.2 | 4371 | Silent Mutation | GGC,GGT | G,G 785 | XP_011531931.1 | |
XM_017006256.1 | 4371 | Silent Mutation | GGC,GGT | G,G 785 | XP_016861745.1 |
PRRT3-AS1 - PRRT3 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |