Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCCACCCTACTCACTGTGGCAGGC[C/T]GCCATGTACACCTCCACCTCAATCT
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 604264 MIM: 610068 | |||||||||||||||||||||||
Literature Links: |
CELSR3 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
CELSR3 - cadherin EGF LAG seven-pass G-type receptor 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6824 - microRNA 6824 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC26A6 - solute carrier family 26 member 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001040454.1 | 2218 | Silent Mutation | GCA,GCG | A,A 685 | NP_001035544.1 | |
NM_001281732.1 | 2218 | Silent Mutation | GCA,GCG | A,A 670 | NP_001268661.1 | |
NM_001281733.1 | 2218 | Silent Mutation | GCA,GCG | A,A 598 | NP_001268662.1 | |
NM_022911.2 | 2218 | Silent Mutation | GCA,GCG | A,A 706 | NP_075062.2 | |
NM_134263.2 | 2218 | Silent Mutation | GCA,GCG | A,A 705 | NP_599025.2 | |
NM_134426.2 | 2218 | Silent Mutation | GCA,GCG | A,A 687 | NP_602298.2 |
TMEM89 - transmembrane protein 89 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |