Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCCAGTAGAAGTCTGCCCAAGTTA[C/G]CTAGTTTAAAGGAAACAAACTTTTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602598 MIM: 612761 | ||||||||||||||||||||
Literature Links: |
HPGDS PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HPGDS - hematopoietic prostaglandin D synthase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014485.2 | 527 | Missense Mutation | CTA,GTA | L,V 146 | NP_055300.1 | |
XM_005262932.2 | 527 | Missense Mutation | CTA,GTA | L,V 115 | XP_005262989.1 |
SMARCAD1 - SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |