Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGGACTTTACCTTATTTGTATGTC[A/G]TGCTGCATCGAAGAATGAAATCAAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607590 MIM: 123835 MIM: 606180 | ||||||||||||||||||||
Literature Links: |
BBS7 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BBS7 - Bardet-Biedl syndrome 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_018190.3 | 4343 | Intron | NP_060660.2 | |||
XM_017008358.1 | 4343 | UTR 3 | XP_016863847.1 |
CCNA2 - cyclin A2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EXOSC9 - exosome component 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |