Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCGAAATAAAAGGAAGAGGAAGACA[A/G]GTGACGATGGCGGAGATTCTCCCGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610398 | ||||||||||||||||||||
Literature Links: |
SAP30L PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
SAP30L - SAP30 like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001131062.1 | 925 | Intron | NP_001124534.1 | |||
NM_001131063.1 | 925 | Intron | NP_001124535.1 | |||
NM_024632.5 | 925 | Missense Mutation | AGT,GGT | S,G 93 | NP_078908.1 |
SAP30L-AS1 - SAP30L antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |