Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACCGTTCGAGCAGCGCGCCTATCC[G/T]CACGTCTTCACTAAAGGAATCCCCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604417 MIM: 601918 MIM: 611373 MIM: 612080 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
AFF4 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
AFF4 - AF4/FMR2 family member 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GDF9 - growth differentiation factor 9 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001288824.2 | 158 | Intron | NP_001275753.1 | |||
NM_001288825.2 | 158 | Intron | NP_001275754.1 | |||
NM_001288826.2 | 158 | Intron | NP_001275755.1 | |||
NM_001288827.2 | 158 | Intron | NP_001275756.1 | |||
NM_001288828.2 | 158 | Intron | NP_001275757.1 | |||
XM_005271957.4 | 158 | Intron | XP_005272014.1 | |||
XM_006714585.3 | 158 | Intron | XP_006714648.1 | |||
XM_011543308.2 | 158 | Intron | XP_011541610.1 | |||
XM_011543309.1 | 158 | Intron | XP_011541611.1 | |||
XM_011543310.1 | 158 | Intron | XP_011541612.1 | |||
XM_011543311.2 | 158 | Intron | XP_011541613.1 |
LEAP2 - liver enriched antimicrobial peptide 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UQCRQ - ubiquinol-cytochrome c reductase complex III subunit VII | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014402.4 | 158 | Silent Mutation | CCG,CCT | P,P 28 | NP_055217.2 |