Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAAATCTGCTCCAGTCCCTAAAAAA[A/G]GCTCCAAGAAGGCCATTAACAAGGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602787 MIM: 602791 MIM: 602800 MIM: 602802 MIM: 602818 MIM: 602826 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
HIST1H2AI PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
HIST1H2AI - histone cluster 1, H2ai | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HIST1H2AJ - histone cluster 1, H2aj | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_021066.2 | Intron | NP_066544.1 |
HIST1H2BL - histone cluster 1, H2bl | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HIST1H2BM - histone cluster 1, H2bm | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003521.2 | Intron | NP_003512.1 |
HIST1H3H - histone cluster 1, H3h | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HIST1H4J - histone cluster 1, H4j | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |