Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCTGGTGCCACGTCACCACAGTGA[C/G]GCGCCTCACCTTCAGCAGCGCCTAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604548 MIM: 186975 | ||||||||||||||||||||
Literature Links: |
NFKBIE PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
NFKBIE - NFKB inhibitor epsilon | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TCTE1 - t-complex-associated-testis-expressed 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM151B - transmembrane protein 151B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001137560.1 | 263 | Missense Mutation | ACG,AGG | T,R 88 | NP_001131032.1 |