Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCATCACCCGCTGGTGGGAGGACCT[A/G]GAGAGGGACTTCCCTTGTCCTGTCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605700 | ||||||||||||||||||||
Literature Links: |
HCG17 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HCG17 - HLA complex group 17 (non-protein coding) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HCG18 - HLA complex group 18 (non-protein coding) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRIM39 - tripartite motif containing 39 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_021253.3 | 187 | Silent Mutation | CTA,CTG | L,L 60 | NP_067076.2 | |
NM_172016.2 | 187 | Silent Mutation | CTA,CTG | L,L 60 | NP_742013.1 |
TRIM39-RPP21 - TRIM39-RPP21 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001199119.1 | 187 | Silent Mutation | CTA,CTG | L,L 60 | NP_001186048.1 |