Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCGGGCCTTGAAGCCATTCTTGTC[A/G]GCGCTGTGGTCCCCGTGGAAGTCCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606582 MIM: 612266 | ||||||||||||||||||||
Literature Links: |
DLL1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DLL1 - delta like canonical Notch ligand 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005618.3 | 2351 | Silent Mutation | GCC,GCT | A,A 627 | NP_005609.3 | |
XM_005266934.3 | 2351 | Intron | XP_005266991.1 |
FAM120B - family with sequence similarity 120B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LINC01624 - long intergenic non-protein coding RNA 1624 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC285804 - uncharacterized LOC285804 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |