Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATCTGCCACCTTCTCAGCTGCCCG[C/T]TTCTCAGCTTGCAGAAGCTGCTGGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606853 MIM: 142560 MIM: 601022 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ATP6V1G2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ATP6V1G2 - ATPase H+ transporting V1 subunit G2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001204078.1 | 337 | Silent Mutation | AAA,AAG | K,K 16 | NP_001191007.1 | |
NM_130463.3 | 337 | Silent Mutation | AAA,AAG | K,K 16 | NP_569730.1 | |
NM_138282.2 | 337 | Intron | NP_612139.1 |
ATP6V1G2-DDX39B - ATP6V1G2-DDX39B readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DDX39B - DEAD-box helicase 39B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DDX39B-AS1 - DDX39B antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100287329 - uncharacterized LOC100287329 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NFKBIL1 - NFKB inhibitor like 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001144961.1 | 337 | Intron | NP_001138433.1 | |||
NM_001144962.1 | 337 | Intron | NP_001138434.1 | |||
NM_001144963.1 | 337 | Intron | NP_001138435.1 | |||
NM_005007.3 | 337 | Intron | NP_004998.3 |
SNORD84 - small nucleolar RNA, C/D box 84 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |