Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGCTGTGGCGTTGAGGACGGTGGT[A/G]GGAAGCCGAGCAGCAGGGAGCATGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610060 MIM: 612658 MIM: 609775 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LRRC73 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LRRC73 - leucine rich repeat containing 73 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
POLR1C - RNA polymerase I subunit C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TJAP1 - tight junction associated protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
YIPF3 - Yip1 domain family member 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_015388.3 | 1215 | Silent Mutation | CCC,CCT | P,P 332 | NP_056203.2 | |
XM_005248989.4 | 1215 | Silent Mutation | CCC,CCT | P,P 297 | XP_005249046.1 | |
XM_005248990.2 | 1215 | Silent Mutation | CCC,CCT | P,P 297 | XP_005249047.1 | |
XM_011514458.2 | 1215 | Silent Mutation | CCC,CCT | P,P 297 | XP_011512760.1 |