Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAAGCCATACAGGGTGCGGCCCTGG[C/T]GCTTGAGCGCGTAAACCACGTCCAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 142711 MIM: 602793 MIM: 602814 MIM: 602831 | ||||||||||||||||||||
Literature Links: |
HIST1H1B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HIST1H1B - histone cluster 1, H1b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HIST1H2AL - histone cluster 1, H2al | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HIST1H3I - histone cluster 1, H3i | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003533.2 | 279 | Intron | NP_003524.1 |
HIST1H4L - histone cluster 1, H4l | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003546.2 | 279 | Missense Mutation | CAC,CGC | H,R 93 | NP_003537.1 |