Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAGTGGATTGACCCCAACACTCAC[A/G]CTGCTGCCGCTACCCCCGGTTCCCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 120290 MIM: 601417 MIM: 180246 MIM: 601416 | ||||||||||||||||||||
Literature Links: |
COL11A2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
COL11A2 - collagen type XI alpha 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HSD17B8 - hydroxysteroid 17-beta dehydrogenase 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RXRB - retinoid X receptor beta | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001270401.1 | 1163 | Silent Mutation | AGC,AGT | S,S 331 | NP_001257330.1 | |
NM_001291989.1 | 1163 | Silent Mutation | AGC,AGT | S,S 141 | NP_001278918.1 | |
NM_021976.4 | 1163 | Silent Mutation | AGC,AGT | S,S 331 | NP_068811.1 | |
XM_005249278.2 | 1163 | Silent Mutation | AGC,AGT | S,S 235 | XP_005249335.1 | |
XM_011514796.2 | 1163 | Silent Mutation | AGC,AGT | S,S 214 | XP_011513098.1 | |
XM_017011176.1 | 1163 | Silent Mutation | AGC,AGT | S,S 208 | XP_016866665.1 |
SLC39A7 - solute carrier family 39 member 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |