Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGAGTGCACCGCCTGCTCCGCAAAG[A/G]CAACTATGCCGAGCGGGTCGGGGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615012 MIM: 615044 MIM: 615045 MIM: 602833 | ||||||||||||||||||||
Literature Links: |
HIST1H2AG PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HIST1H2AG - histone cluster 1, H2ag | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_021064.4 | 147 | Missense Mutation | GAC,GGC | D,G 38 | NP_066408.1 |
HIST1H2BJ - histone cluster 1, H2bj | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_021058.3 | 147 | Intron | NP_066402.2 |
HIST1H2BK - histone cluster 1, H2bk | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HIST1H4I - histone cluster 1, H4i | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |