Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGCTGCAGGATTAAGTAATGATGA[A/G]TCTTCCCTTTCAACTGTTGTTAAAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608994 MIM: 600772 | ||||||||||||||||||||
Literature Links: |
ANKS1A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ANKS1A - ankyrin repeat and sterile alpha motif domain containing 1A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105375030 - uncharacterized LOC105375030 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAF11 - TATA-box binding protein associated factor 11 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001270488.1 | 723 | Silent Mutation | GAC,GAT | D,D 73 | NP_001257417.1 | |
NM_005643.3 | 723 | Silent Mutation | GAC,GAT | D,D 73 | NP_005634.1 | |
XM_011514827.2 | 723 | Silent Mutation | GAC,GAT | D,D 29 | XP_011513129.1 |
UHRF1BP1 - UHRF1 binding protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |