Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGCAGCCCAATTTCCTGAGTGGAA[C/G]TGGGGGACACAGGCAGGCTCAGGCG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612931 MIM: 606344 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MIR6838 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MIR6838 - microRNA 6838 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PGAM2 - phosphoglycerate mutase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
POLM - DNA polymerase mu | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001284330.1 | 1514 | Missense Mutation | CAC,CAG | H,Q 439 | NP_001271259.1 | |
NM_001284331.1 | 1514 | UTR 3 | NP_001271260.1 | |||
NM_013284.3 | 1514 | UTR 3 | NP_037416.1 | |||
XM_005249711.2 | 1514 | Missense Mutation | CAC,CAG | H,Q 379 | XP_005249768.1 | |
XM_006715692.2 | 1514 | Missense Mutation | CAC,CAG | H,Q 519 | XP_006715755.1 | |
XM_006715696.2 | 1514 | Missense Mutation | CAC,CAG | H,Q 429 | XP_006715759.1 | |
XM_006715698.3 | 1514 | Missense Mutation | CAC,CAG | H,Q 292 | XP_006715761.1 | |
XM_011515275.1 | 1514 | Missense Mutation | CAC,CAG | H,Q 524 | XP_011513577.1 | |
XM_011515278.1 | 1514 | Missense Mutation | CAC,CAG | H,Q 474 | XP_011513580.1 | |
XM_011515279.1 | 1514 | UTR 3 | XP_011513581.1 | |||
XM_011515282.2 | 1514 | Missense Mutation | CAC,CAG | H,Q 291 | XP_011513584.1 | |
XM_011515285.1 | 1514 | Missense Mutation | CAC,CAG | H,Q 255 | XP_011513587.1 | |
XM_011515286.2 | 1514 | Intron | XP_011513588.1 | |||
XM_011515287.2 | 1514 | Intron | XP_011513589.1 | |||
XM_017011998.1 | 1514 | Missense Mutation | CAC,CAG | H,Q 462 | XP_016867487.1 | |
XM_017011999.1 | 1514 | Missense Mutation | CAC,CAG | H,Q 444 | XP_016867488.1 | |
XM_017012000.1 | 1514 | UTR 3 | XP_016867489.1 | |||
XM_017012001.1 | 1514 | UTR 3 | XP_016867490.1 | |||
XM_017012002.1 | 1514 | Missense Mutation | CAC,CAG | H,Q 255 | XP_016867491.1 | |
XM_017012003.1 | 1514 | Missense Mutation | CAC,CAG | H,Q 255 | XP_016867492.1 | |
XM_017012004.1 | 1514 | Intron | XP_016867493.1 | |||
XM_017012005.1 | 1514 | Intron | XP_016867494.1 |