Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCGGCCCCTGCTGCTGCCCCTACT[A/G]CCCTTGCTGCTGCCGCCAGCATTTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605341 MIM: 605342 | ||||||||||||||||||||
Literature Links: |
PILRA PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PILRA - paired immunoglobin like type 2 receptor alpha | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_013439.2 | 242 | Silent Mutation | CTA,CTG | L,L 10 | NP_038467.2 | |
NM_178272.1 | 242 | Silent Mutation | CTA,CTG | L,L 10 | NP_840056.1 | |
NM_178273.1 | 242 | Silent Mutation | CTA,CTG | L,L 10 | NP_840057.1 |
PILRB - paired immunoglobin-like type 2 receptor beta | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STAG3L5P-PVRIG2P-PILRB - STAG3L5P-PVRIG2P-PILRB readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |