Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGGACTGCTGTGCCTCCTCCTCCT[C/G]TGGTGGAGGAGAAGGAAAGGTAAGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605342 | ||||||||||||||||||||
Literature Links: |
MIR6840 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR6840 - microRNA 6840 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PILRB - paired immunoglobin-like type 2 receptor beta | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_178238.3 | 936 | Silent Mutation | CTC,CTG | L,L 212 | NP_839956.1 |
PVRIG2P - poliovirus receptor related immunoglobulin domain containing 2, pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STAG3L5P-PVRIG2P-PILRB - STAG3L5P-PVRIG2P-PILRB readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |