Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCGTTGTTGATGAGGATGCTCTCC[C/T]GGATGGTCAGGGTGCAGTAGTACCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 124015 MIM: 616695 MIM: 616550 | ||||||||||||||||||||
Literature Links: |
POR PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
POR - cytochrome p450 oxidoreductase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STYXL1 - serine/threonine/tyrosine interacting-like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM120A - transmembrane protein 120A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001317803.1 | 637 | Missense Mutation | NP_001304732.1 | |||
NM_031925.2 | 637 | Missense Mutation | NP_114131.1 |