Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTAGGCCGTCCGGGCCCTTTTGCC[C/T]TCCGGGCCGCCTATGTTGTCTGCAA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 142954 MIM: 142952 MIM: 142951 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
HOXA-AS3 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
HOXA-AS3 - HOXA cluster antisense RNA 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HOXA3 - homeobox A3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_030661.4 | 643 | Intron | NP_109377.1 | |||
NM_153631.2 | 643 | Intron | NP_705895.1 | |||
XM_005249730.2 | 643 | Intron | XP_005249787.1 | |||
XM_005249731.2 | 643 | Intron | XP_005249788.1 | |||
XM_005249732.3 | 643 | Intron | XP_005249789.1 | |||
XM_006715715.2 | 643 | Intron | XP_006715778.1 | |||
XM_011515343.2 | 643 | Intron | XP_011513645.1 |
HOXA5 - homeobox A5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_019102.3 | 643 | Silent Mutation | GAA,GAG | E,E 194 | NP_061975.2 |
HOXA6 - homeobox A6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |