Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCTTCAGGGACAGCCAGATCCAGC[A/G]CCTCGCCCAGGGCCTCCTGCTGGGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609125 MIM: 600270 MIM: 604720 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MOSPD3 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MOSPD3 - motile sperm domain containing 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001040097.1 | 601 | Silent Mutation | GCA,GCG | A,A 151 | NP_001035186.1 | |
NM_001040098.1 | 601 | Silent Mutation | GCA,GCG | A,A 151 | NP_001035187.1 | |
NM_001040099.1 | 601 | Silent Mutation | GCA,GCG | A,A 141 | NP_001035188.1 | |
NM_023948.4 | 601 | Silent Mutation | GCA,GCG | A,A 151 | NP_076438.1 | |
XM_005250529.4 | 601 | Silent Mutation | GCA,GCG | A,A 151 | XP_005250586.1 | |
XM_005250531.3 | 601 | Silent Mutation | GCA,GCG | A,A 151 | XP_005250588.1 |
PCOLCE - procollagen C-endopeptidase enhancer | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCOLCE-AS1 - PCOLCE antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TFR2 - transferrin receptor 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |