Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCTGGCCACCTTGCTGGACCCTTG[C/G]TTCAAGGGGAAGATTGAGGCCATCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601973 MIM: 615252 | ||||||||||||||||||||
Literature Links: |
ACTR3C PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ACTR3C - ARP3 actin-related protein 3 homolog C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LRRC61 - leucine rich repeat containing 61 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001142928.1 | 796 | Intron | NP_001136400.1 | |||
NM_023942.2 | 796 | Intron | NP_076431.1 | |||
XM_006716095.2 | 796 | Intron | XP_006716158.1 |
RARRES2 - retinoic acid receptor responder 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZBED6CL - ZBED6 C-terminal like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_138434.2 | 796 | Silent Mutation | TGC,TGG | C,W 80 | NP_612443.1 |