Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCTGTGCATGCTCTGGGGTCCACA[C/T]GAGCCTCACAGCAAGGAAGTCTTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608235 | ||||||||||||||||||||
Literature Links: |
C7orf43 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C7orf43 - chromosome 7 open reading frame 43 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001303470.1 | 935 | Missense Mutation | ATG,GTG | M,V 136 | NP_001290399.1 | |
NM_018275.4 | 935 | Missense Mutation | ATG,GTG | M,V 405 | NP_060745.3 |
GAL3ST4 - galactose-3-O-sulfotransferase 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LAMTOR4 - late endosomal/lysosomal adaptor, MAPK and MTOR activator 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4658 - microRNA 4658 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |