Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGGAGGAGGGCCGGGTGGGCCGGA[A/G]GGTGGGGATGCTGAGGGCCCCATCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 616861 MIM: 614469 MIM: 602933 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MIR6875 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MIR6875 - microRNA 6875 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC12A9 - solute carrier family 12 member 9 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001267812.1 | 2137 | Intron | NP_001254741.1 | |||
NM_001267814.1 | 2137 | Intron | NP_001254743.1 | |||
NM_020246.3 | 2137 | Silent Mutation | GAA,GAG | E,E 857 | NP_064631.2 | |
XM_005250502.2 | 2137 | Silent Mutation | GAA,GAG | E,E 768 | XP_005250559.1 | |
XM_005250504.4 | 2137 | Silent Mutation | GAA,GAG | E,E 499 | XP_005250561.1 | |
XM_006716054.2 | 2137 | Silent Mutation | GAA,GAG | E,E 768 | XP_006716117.1 | |
XM_006716055.2 | 2137 | Silent Mutation | GAA,GAG | E,E 754 | XP_006716118.1 | |
XM_011516414.1 | 2137 | Silent Mutation | GAA,GAG | E,E 665 | XP_011514716.1 |
SRRT - serrate, RNA effector molecule | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRIP6 - thyroid hormone receptor interactor 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003302.2 | 2137 | Intron | NP_003293.2 |