Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GACTCCCCGGAGATGGTAAGGGTGA[A/G]GCTGCCCCTGCGCTCCGGCACGGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611927 | ||||||||||||||||||||
Literature Links: |
FAM83H PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAM83H - family with sequence similarity 83 member H | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_198488.3 | 4074 | Missense Mutation | CTC,TTC | L,F 937 | NP_940890.3 | |
XM_005250887.3 | 4074 | Missense Mutation | CTC,TTC | L,F 956 | XP_005250944.1 | |
XM_005250888.3 | 4074 | Missense Mutation | CTC,TTC | L,F 943 | XP_005250945.1 | |
XM_005250889.3 | 4074 | Missense Mutation | CTC,TTC | L,F 937 | XP_005250946.1 | |
XM_011516980.2 | 4074 | Missense Mutation | CTC,TTC | L,F 1138 | XP_011515282.2 | |
XM_011516981.2 | 4074 | Missense Mutation | CTC,TTC | L,F 993 | XP_011515283.1 |
FAM83H-AS1 - FAM83H antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAPK15 - mitogen-activated protein kinase 15 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4664 - microRNA 4664 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |