Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGGGTCTCACTCACCTCCTGGGAC[C/T]TCCTGGGTGAGCCATCTTCCAGGTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607212 MIM: 609491 MIM: 602777 | ||||||||||||||||||||
Literature Links: |
CARD9 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CARD9 - caspase recruitment domain family member 9 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_052813.4 | 1467 | Missense Mutation | NP_434700.2 | |||
NM_052814.3 | 1467 | Missense Mutation | NP_434701.1 |
DNLZ - DNL-type zinc finger | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GPSM1 - G-protein signaling modulator 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNAPC4 - small nuclear RNA activating complex polypeptide 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |