Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GACCTCACCTGGCACTGCCCCCCAG[A/C]TTCAGAGCCAGTCTCCCCAGGGGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
CFAP157 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CFAP157 - cilia and flagella associated protein 157 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001012502.2 | 1474 | Intron | NP_001012520.2 | |||
XM_006717064.3 | 1474 | Intron | XP_006717127.2 | |||
XM_011518559.2 | 1474 | Intron | XP_011516861.2 | |||
XM_017014629.1 | 1474 | Intron | XP_016870118.1 | |||
XM_017014630.1 | 1474 | Intron | XP_016870119.1 |
PTRH1 - peptidyl-tRNA hydrolase 1 homolog | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001002913.1 | 1474 | Missense Mutation | NP_001002913.1 | |||
XM_006716955.3 | 1474 | Missense Mutation | XP_006717018.1 | |||
XM_017014276.1 | 1474 | Missense Mutation | XP_016869765.1 | |||
XM_017014277.1 | 1474 | Missense Mutation | XP_016869766.1 | |||
XM_017014278.1 | 1474 | Intron | XP_016869767.1 |
TTC16 - tetratricopeptide repeat domain 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |