Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGGCATCTGTGCTGTTGTTGGGCC[C/T]GGAGCCGGGGATGGCCTGGGATGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611180 MIM: 602660 | ||||||||||||||||||||
Literature Links: |
C9orf173-AS1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C9orf173-AS1 - C9orf173 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FAM166A - family with sequence similarity 166 member A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001001710.2 | 166 | Intron | NP_001001710.1 | |||
XM_006717108.2 | 166 | Intron | XP_006717171.2 | |||
XM_011518694.1 | 166 | Intron | XP_011516996.1 | |||
XM_011518695.1 | 166 | Intron | XP_011516997.1 | |||
XM_011518696.2 | 166 | Intron | XP_011516998.1 | |||
XM_011518697.1 | 166 | Intron | XP_011516999.1 | |||
XM_017014718.1 | 166 | Intron | XP_016870207.1 |
NELFB - negative elongation factor complex member B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STPG3 - sperm-tail PG-rich repeat containing 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001004353.3 | 166 | Missense Mutation | CCG,CTG | P,L 47 | NP_001004353.2 | |
NM_001256699.1 | 166 | Missense Mutation | CCG,CTG | P,L 47 | NP_001243628.1 | |
NM_001256700.1 | 166 | Missense Mutation | CCG,CTG | P,L 47 | NP_001243629.1 | |
NM_001256701.1 | 166 | Missense Mutation | CCG,CTG | P,L 47 | NP_001243630.1 | |
XM_006717113.2 | 166 | Missense Mutation | CCG,CTG | P,L 47 | XP_006717176.1 | |
XM_006717115.2 | 166 | Missense Mutation | CCG,CTG | P,L 47 | XP_006717178.1 |
TUBB4B - tubulin beta 4B class IVb | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |