Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAAAAGGGAAGGATGCCGCTCTTC[C/T]TCCGGAAGCGGAAACCCAGTGAGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610933 MIM: 180475 MIM: 194552 | ||||||||||||||||||||
Literature Links: |
LRSAM1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LRSAM1 - leucine rich repeat and sterile alpha motif containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001005373.3 | 1384 | Missense Mutation | CTC,TTC | L,F 5 | NP_001005373.1 | |
NM_001005374.3 | 1384 | Missense Mutation | CTC,TTC | L,F 5 | NP_001005374.1 | |
NM_001190723.2 | 1384 | Missense Mutation | CTC,TTC | L,F 5 | NP_001177652.1 | |
NM_138361.5 | 1384 | Missense Mutation | CTC,TTC | L,F 5 | NP_612370.3 | |
XM_006717316.3 | 1384 | Missense Mutation | CTC,TTC | L,F 5 | XP_006717379.1 | |
XM_017015283.1 | 1384 | Missense Mutation | CTC,TTC | L,F 5 | XP_016870772.1 | |
XM_017015284.1 | 1384 | UTR 5 | XP_016870773.1 |
RPL12 - ribosomal protein L12 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA65 - small nucleolar RNA, H/ACA box 65 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF79 - zinc finger protein 79 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |