Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGTCAGCTTCAGCCCTGACTCGAGA[C/T]AGCTGGCATCAGGTGGCTGGGACAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
ARPC5L PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARPC5L - actin related protein 2/3 complex subunit 5 like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL35 - ribosomal protein L35 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WDR38 - WD repeat domain 38 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001045476.2 | 437 | Nonsense Mutation | CAG,TAG | Q,* 119 | NP_001038941.1 | |
NM_001276374.1 | 437 | Nonsense Mutation | CAG,TAG | Q,* 119 | NP_001263303.1 | |
NM_001276375.1 | 437 | Nonsense Mutation | CAG,TAG | Q,* 108 | NP_001263304.1 | |
NM_001276376.1 | 437 | Nonsense Mutation | CAG,TAG | Q,* 70 | NP_001263305.1 | |
XM_005251987.3 | 437 | Nonsense Mutation | CAG,TAG | Q,* 119 | XP_005252044.1 |