Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTTCCTCAGGTTTCTCTTTACCACA[G/T]TCCTCATTCCAGGGTGTGCCCTCTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600709 MIM: 611534 | ||||||||||||||||||||
Literature Links: |
IARS PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
IARS - isoleucyl-tRNA synthetase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR3651 - microRNA 3651 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NOL8 - nucleolar protein 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256394.1 | 3022 | Missense Mutation | GAA,GAC | E,D 951 | NP_001243323.1 | |
NM_017948.5 | 3022 | Missense Mutation | GAA,GAC | E,D 1019 | NP_060418.4 | |
XM_006717166.3 | 3022 | Missense Mutation | GAA,GAC | E,D 1019 | XP_006717229.1 | |
XM_006717167.3 | 3022 | Missense Mutation | GAA,GAC | E,D 1019 | XP_006717230.1 | |
XM_006717168.3 | 3022 | Missense Mutation | GAA,GAC | E,D 981 | XP_006717231.1 | |
XM_006717169.3 | 3022 | Missense Mutation | GAA,GAC | E,D 951 | XP_006717232.1 | |
XM_006717170.3 | 3022 | Missense Mutation | GAA,GAC | E,D 951 | XP_006717233.1 | |
XM_006717172.3 | 3022 | Missense Mutation | GAA,GAC | E,D 893 | XP_006717235.1 | |
XM_006717173.3 | 3022 | Missense Mutation | GAA,GAC | E,D 893 | XP_006717236.1 | |
XM_011518824.2 | 3022 | Missense Mutation | GAA,GAC | E,D 951 | XP_011517126.1 | |
XM_011518827.2 | 3022 | Missense Mutation | GAA,GAC | E,D 893 | XP_011517129.1 | |
XM_017014876.1 | 3022 | Missense Mutation | GAA,GAC | E,D 981 | XP_016870365.1 | |
XM_017014877.1 | 3022 | Missense Mutation | GAA,GAC | E,D 913 | XP_016870366.1 | |
XM_017014878.1 | 3022 | Missense Mutation | GAA,GAC | E,D 893 | XP_016870367.1 | |
XM_017014879.1 | 3022 | Missense Mutation | GAA,GAC | E,D 893 | XP_016870368.1 | |
XM_017014880.1 | 3022 | Missense Mutation | GAA,GAC | E,D 855 | XP_016870369.1 |
SNORA84 - small nucleolar RNA, H/ACA box 84 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |