Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCGGTGCCCTTCCCGACCCAGGTG[C/G]TGCGGGAGAAGCTGCGCAAGTACGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615955 MIM: 610615 | ||||||||||||||||||||
Literature Links: |
CCDC183 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CCDC183 - coiled-coil domain containing 183 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001039374.4 | 334 | Missense Mutation | CTG,GTG | L,V 92 | NP_001034463.4 |
CCDC183-AS1 - CCDC183 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RABL6 - RAB, member RAS oncogene family-like 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM141 - transmembrane protein 141 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |