Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACGGTGGGGGCTCTGCTCCCGTAA[G/T]CCTGGTTACTGGTCCTGTACACGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614502 MIM: 611971 MIM: 614056 | ||||||||||||||||||||
Literature Links: |
C9orf116 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C9orf116 - chromosome 9 open reading frame 116 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001048265.1 | 249 | Missense Mutation | GAT,GCT | D,A 62 | NP_001041730.1 | |
NM_144654.2 | 249 | Missense Mutation | GAT,GCT | D,A 62 | NP_653255.1 |
LOC101928525 - uncharacterized LOC101928525 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRPS2 - mitochondrial ribosomal protein S2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPP1R26 - protein phosphatase 1 regulatory subunit 26 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |