Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCTCAGGTTCATAGGGCAAAAGTT[C/T]CCCCAGAGACAAGGGTACTGGTGTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609997 MIM: 108961 MIM: 605731 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
FAM221B PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FAM221B - family with sequence similarity 221 member B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HINT2 - histidine triad nucleotide binding protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NPR2 - natriuretic peptide receptor 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003995.3 | 1460 | Intron | NP_003986.2 | |||
XM_005251478.3 | 1460 | Intron | XP_005251535.1 | |||
XM_005251479.4 | 1460 | Intron | XP_005251536.1 | |||
XM_011517890.2 | 1460 | Intron | XP_011516192.1 | |||
XM_011517891.2 | 1460 | Intron | XP_011516193.1 | |||
XM_011517892.2 | 1460 | Intron | XP_011516194.1 | |||
XM_011517893.2 | 1460 | Intron | XP_011516195.1 | |||
XM_011517895.2 | 1460 | Intron | XP_011516197.1 | |||
XM_017014745.1 | 1460 | Intron | XP_016870234.1 | |||
XM_017014746.1 | 1460 | Intron | XP_016870235.1 | |||
XM_017014747.1 | 1460 | Intron | XP_016870236.1 | |||
XM_017014748.1 | 1460 | Intron | XP_016870237.1 | |||
XM_017014749.1 | 1460 | Intron | XP_016870238.1 | |||
XM_017014750.1 | 1460 | Intron | XP_016870239.1 |
SPAG8 - sperm associated antigen 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001039592.1 | 1460 | Missense Mutation | AAA,GAA | K,E 449 | NP_001034681.1 | |
NM_172312.1 | 1460 | Intron | NP_758516.1 |