Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAATTTCTTATCAAACCTGAATCC[A/G]AAGTTGCTAAGTTGGACACGTCTCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 300126 | ||||||||||||||||||||
Literature Links: |
DKC1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DKC1 - dyskerin pseudouridine synthase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001142463.2 | 351 | Missense Mutation | AAA,GAA | K,E 43 | NP_001135935.1 | |
NM_001288747.1 | 351 | Missense Mutation | AAA,GAA | K,E 43 | NP_001275676.1 | |
NM_001363.4 | 351 | Missense Mutation | AAA,GAA | K,E 43 | NP_001354.1 |
MIR664B - microRNA 664b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA36A - small nucleolar RNA, H/ACA box 36A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA56 - small nucleolar RNA, H/ACA box 56 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |