Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTTTCCATGCCAGCAGGCTGGTCG[C/T]GCCAGAATTGAGTTCCAGAGGTGGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 300110 MIM: 300859 MIM: 300292 | ||||||||||||||||||||
Literature Links: |
CACNA1F PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CACNA1F - calcium voltage-gated channel subunit alpha1 F | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CCDC22 - coiled-coil domain containing 22 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014008.4 | 682 | Missense Mutation | GCG,GTG | A,V 171 | NP_054727.1 | |
XM_005272599.3 | 682 | Missense Mutation | GCG,GTG | A,V 171 | XP_005272656.1 |
FOXP3 - forkhead box P3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |