Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GATGCTGTATCTGCCACAAGCGAGA[C/G]TTGTTATCCATGTAGCGCTCCTCCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 300617 MIM: 300116 | ||||||||||||||||||||
Literature Links: |
BRCC3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BRCC3 - BRCA1/BRCA2-containing complex subunit 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CMC4 - C-X9-C motif containing 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001018024.2 | 869 | Intron | NP_001018024.1 |
FUNDC2 - FUN14 domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MTCP1 - mature T-cell proliferation 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001018025.3 | 869 | Missense Mutation | AAC,AAG | N,K 81 | NP_001018025.1 |