Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCTGGGCTGCGGTCAATGGGATCT[G/C]GGTGGAGCTACCTGTGGTGGTCAAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609076 MIM: 607882 | ||||||||||||||||||||
Literature Links: |
FBXL6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FBXL6 - F-box and leucine rich repeat protein 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_012162.3 | 653 | Intron | NP_036294.2 | |||
NM_024555.5 | 653 | Intron | NP_078831.4 |
LOC101928902 - uncharacterized LOC101928902 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC52A2 - solute carrier family 52 member 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001253815.1 | 653 | Missense Mutation | TCG,TGG | S,W 31 | NP_001240744.1 | |
NM_001253816.1 | 653 | Missense Mutation | TCG,TGG | S,W 31 | NP_001240745.1 | |
NM_024531.4 | 653 | Missense Mutation | TCG,TGG | S,W 31 | NP_078807.1 | |
XM_006716658.2 | 653 | Missense Mutation | TCG,TGG | S,W 31 | XP_006716721.1 | |
XM_006716659.2 | 653 | Missense Mutation | TCG,TGG | S,W 31 | XP_006716722.1 | |
XM_006716660.2 | 653 | Missense Mutation | TCG,TGG | S,W 31 | XP_006716723.1 | |
XM_011517300.2 | 653 | Intron | XP_011515602.1 | |||
XM_017013819.1 | 653 | Missense Mutation | TCG,TGG | S,W 31 | XP_016869308.1 | |
XM_017013820.1 | 653 | Missense Mutation | TCG,TGG | S,W 31 | XP_016869309.1 | |
XM_017013821.1 | 653 | Missense Mutation | TCG,TGG | S,W 31 | XP_016869310.1 | |
XM_017013822.1 | 653 | Missense Mutation | TCG,TGG | S,W 31 | XP_016869311.1 |
TMEM249 - transmembrane protein 249 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |