Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTTCTTAACTGATAAAAAGTACTTA[C/G]TGGTTGTGTAAAAAATATTCGTAAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615172 MIM: 608938 | ||||||||||||||||||||
Literature Links: |
LOC101927755 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC101927755 - uncharacterized LOC101927755 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNFT1 - ring finger protein, transmembrane 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016125.3 | Intron | NP_057209.3 |
RPS6KB1 - ribosomal protein S6 kinase B1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TBC1D3P1-DHX40P1 - TBC1D3P1-DHX40P1 readthrough, transcribed pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |