Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCGGCCGCCCGCCTCTGCCGCCGCA[A/G]TGATGATGATGGCGCTGAGCAAGAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 185261 MIM: 601607 | ||||||||||||||||||||
Literature Links: |
MMP11 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MMP11 - matrix metallopeptidase 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SMARCB1 - SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001007468.2 | Intron | NP_001007469.1 | ||||
NM_001317946.1 | Intron | NP_001304875.1 | ||||
NM_003073.4 | Intron | NP_003064.2 | ||||
XM_011530345.2 | Intron | XP_011528647.1 |