Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTATCTTCCATTTCTCCCCTCTAAT[A/C]TGACTCTTTTAAATTTAGTTACACA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 102620 MIM: 134637 | ||||||||||||||||||||
Literature Links: |
ACTA2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ACTA2 - actin, alpha 2, smooth muscle, aorta | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FAS - Fas cell surface death receptor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000043.5 | Intron | NP_000034.1 | ||||
NM_001320619.1 | Intron | NP_001307548.1 | ||||
NM_152871.3 | Intron | NP_690610.1 | ||||
NM_152872.3 | Intron | NP_690611.1 | ||||
XM_006717819.3 | Intron | XP_006717882.1 | ||||
XM_011539764.2 | Intron | XP_011538066.1 | ||||
XM_011539765.2 | Intron | XP_011538067.1 | ||||
XM_011539766.2 | Intron | XP_011538068.1 | ||||
XM_011539767.2 | Intron | XP_011538069.1 |
FAS-AS1 - FAS antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |