Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGAGTGGGGAGAAGCATGGCTGAGC[A/G]CTGAGAGGAGGGTTGGGGACGGGAG
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 109170 MIM: 600978 MIM: 611550 MIM: 191160 | |||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
LST1 PubMed Links | |||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | ||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
LST1 - leukocyte specific transcript 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001166538.1 | Intron | NP_001160010.1 | ||||
NM_007161.3 | Intron | NP_009092.3 | ||||
NM_205837.2 | Intron | NP_995309.2 | ||||
NM_205838.2 | Intron | NP_995310.2 | ||||
NM_205839.2 | Intron | NP_995311.2 | ||||
NM_205840.2 | Intron | NP_995312.2 | ||||
XM_006715206.3 | Intron | XP_006715269.1 | ||||
XM_006715209.3 | Intron | XP_006715272.1 | ||||
XM_006715210.3 | Intron | XP_006715273.1 | ||||
XM_011514914.2 | Intron | XP_011513216.1 |
LTB - lymphotoxin beta | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NCR3 - natural cytotoxicity triggering receptor 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145466.1 | Intron | NP_001138938.1 | ||||
NM_001145467.1 | Intron | NP_001138939.1 | ||||
NM_147130.2 | Intron | NP_667341.1 | ||||
XM_006715049.3 | Intron | XP_006715112.1 | ||||
XM_011514459.2 | Intron | XP_011512761.1 |
TNF - tumor necrosis factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |