Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATCAAGGTCAACACTAGGCCAGAAA[A/G]ACTTGGCTTGCAATATCACTGCCCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 177075 MIM: 605131 | ||||||||||||||||||||
Literature Links: |
LOC105371352 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC105371352 - uncharacterized LOC105371352 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAF - MAF bZIP transcription factor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001031804.2 | Intron | NP_001026974.1 | ||||
NM_005360.4 | Intron | NP_005351.2 | ||||
XM_017023233.1 | Intron | XP_016878722.1 | ||||
XM_017023234.1 | Intron | XP_016878723.1 | ||||
XM_017023235.1 | Intron | XP_016878724.1 |
WWOX - WW domain containing oxidoreductase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |