Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCCCATCAGCTGTGCCCGGGAGCC[A/G]AGATGGCGTTCTCAGGCAGGGGCAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610714 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
LOC100506100 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
LOC100506100 - uncharacterized LOC100506100 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PKN3 - protein kinase N3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZDHHC12 - zinc finger DHHC-type containing 12 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZER1 - zyg-11 related cell cycle regulator | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006336.3 | 3017 | UTR 3 | NP_006327.2 | |||
XM_005251645.2 | 3017 | UTR 3 | XP_005251702.1 | |||
XM_005251646.2 | 3017 | UTR 3 | XP_005251703.1 | |||
XM_011518122.2 | 3017 | UTR 3 | XP_011516424.1 | |||
XM_017014185.1 | 3017 | UTR 3 | XP_016869674.1 | |||
XM_017014186.1 | 3017 | UTR 3 | XP_016869675.1 | |||
XM_017014187.1 | 3017 | UTR 3 | XP_016869676.1 | |||
XM_017014188.1 | 3017 | UTR 3 | XP_016869677.1 | |||
XM_017014189.1 | 3017 | UTR 3 | XP_016869678.1 | |||
XM_017014190.1 | 3017 | UTR 3 | XP_016869679.1 |