Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAAACTTTACCTTTAAACAAATAC[A/C]CGGTCTTTTCAGACTACTGAAATTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616173 | ||||||||||||||||||||
Literature Links: |
EFCAB5 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EFCAB5 - EF-hand calcium binding domain 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR3184 - microRNA 3184 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR423 - microRNA 423 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NSRP1 - nuclear speckle splicing regulatory protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001261467.1 | Intron | NP_001248396.1 | ||||
NM_032141.3 | Intron | NP_115517.1 | ||||
XM_011525345.2 | Intron | XP_011523647.1 | ||||
XM_017025209.1 | Intron | XP_016880698.1 | ||||
XM_017025210.1 | Intron | XP_016880699.1 | ||||
XM_017025211.1 | Intron | XP_016880700.1 | ||||
XM_017025212.1 | Intron | XP_016880701.1 | ||||
XM_017025213.1 | Intron | XP_016880702.1 | ||||
XM_017025214.1 | Intron | XP_016880703.1 | ||||
XM_017025215.1 | Intron | XP_016880704.1 |