Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AATTTCACATGGTTTTTCCTATCAG[A/T]ACAGGTTAAGGATAATGGCGTGTTG
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 600162 MIM: 182279 | |||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
PWAR5 PubMed Links | |||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese)
|
||||||
EUR
|
||||||||
AMR
|
PWAR5 - Prader Willi/Angelman region RNA 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PWARSN - Prader Willi/Angelman region RNA, SNRPN neighbor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD107 - small nucleolar RNA, C/D box 107 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD108 - small nucleolar RNA, C/D box 108 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD64 - small nucleolar RNA, C/D box 64 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNRPN - small nuclear ribonucleoprotein polypeptide N | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNURF - SNRPN upstream reading frame | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |