Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAACAGTTAGTCCCTAGCTCCTCC[A/G]TCCCCACCAAGTACCCACACATCCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603488 MIM: 609023 MIM: 610364 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
AAMP PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
AAMP - angio associated migratory cell protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6513 - microRNA 6513 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PNKD - paroxysmal nonkinesigenic dyskinesia | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001077399.2 | 1196 | Intron | NP_001070867.1 | |||
NM_015488.4 | 1196 | Intron | NP_056303.3 | |||
NM_022572.4 | 1196 | Intron | NP_072094.1 | |||
XM_017003771.1 | 1196 | Intron | XP_016859260.1 | |||
XM_017003772.1 | 1196 | Intron | XP_016859261.1 |
TMBIM1 - transmembrane BAX inhibitor motif containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001321427.1 | 1196 | UTR 3 | NP_001308356.1 | |||
NM_001321428.1 | 1196 | UTR 3 | NP_001308357.1 | |||
NM_001321429.1 | 1196 | UTR 3 | NP_001308358.1 | |||
NM_001321430.1 | 1196 | UTR 3 | NP_001308359.1 | |||
NM_001321432.1 | 1196 | UTR 3 | NP_001308361.1 | |||
NM_001321433.1 | 1196 | UTR 3 | NP_001308362.1 | |||
NM_001321435.1 | 1196 | UTR 3 | NP_001308364.1 | |||
NM_001321436.1 | 1196 | UTR 3 | NP_001308365.1 | |||
NM_001321438.1 | 1196 | UTR 3 | NP_001308367.1 | |||
NM_022152.5 | 1196 | UTR 3 | NP_071435.2 | |||
XM_011511627.1 | 1196 | UTR 3 | XP_011509929.1 |