Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACCAGCCTGACAAGCCATGACTCA[C/T]ACCCCCCCAGGTGGAGGAGAGAAGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 608110 MIM: 604114 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ANKRD63 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ANKRD63 - ankyrin repeat domain 63 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
BUB1B-PAK6 - BUB1B-PAK6 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PAK6 - p21 (RAC1) activated kinase 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PLCB2 - phospholipase C beta 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001284297.1 | 3947 | Intron | NP_001271226.1 | |||
NM_001284298.1 | 3947 | Intron | NP_001271227.1 | |||
NM_001284299.1 | 3947 | Intron | NP_001271228.1 | |||
NM_004573.2 | 3947 | Intron | NP_004564.2 | |||
XM_011521674.2 | 3947 | Intron | XP_011519976.1 | |||
XM_017022314.1 | 3947 | Intron | XP_016877803.1 | |||
XM_017022315.1 | 3947 | Intron | XP_016877804.1 | |||
XM_017022316.1 | 3947 | Intron | XP_016877805.1 | |||
XM_017022317.1 | 3947 | Intron | XP_016877806.1 | |||
XM_017022318.1 | 3947 | Intron | XP_016877807.1 | |||
XM_017022319.1 | 3947 | UTR 3 | XP_016877808.1 |