Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAACACCATCCATATGGCACCATAA[C/T]ATTGTTTTGTTCTGAGAATTCTGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600620 MIM: 616234 | ||||||||||||||||||||
Literature Links: |
FKBP1B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FKBP1B - FK506 binding protein 1B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MFSD2B - major facilitator superfamily domain containing 2B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WDCP - WD repeat and coiled coil containing | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001142319.1 | 2569 | UTR 3 | NP_001135791.1 | |||
NM_025203.2 | 2569 | UTR 3 | NP_079479.1 | |||
XM_017005029.1 | 2569 | Intron | XP_016860518.1 |